| Measure | Value |
| Sample ID | SRR837476 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 10323437 |
| Number of trimmed reads | 10166536 (98.5%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 67711 159006 |
| Average read length | 23.565 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 10096720 |
| Number of uniquely mapped reads | 6698790 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |