| Measure | Value |
| Sample ID | SRR837474 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 12085433 |
| Number of trimmed reads | 11940145 (98.8%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 86745 148545 |
| Average read length | 23.725 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 11850143 |
| Number of uniquely mapped reads | 8231343 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |