| Measure | Value |
| Sample ID | SRR837473 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 10476962 |
| Number of trimmed reads | 10345049 (98.7%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 183139 133936 |
| Average read length | 23.525 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 10159887 |
| Number of uniquely mapped reads | 6735708 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |