| Measure | Value |
| Sample ID | SRR837470 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 21220553 |
| Number of trimmed reads | 20751155 (97.8%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 520854 498746 |
| Average read length | 23.59 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 20200953 |
| Number of uniquely mapped reads | 10351870 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |