| Measure | Value |
| Sample ID | SRR837468 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 17467561 |
| Number of trimmed reads | 17156942 (98.2%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 510605 349248 |
| Average read length | 23.805 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 16607708 |
| Number of uniquely mapped reads | 8333786 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |