| Measure | Value |
| Sample ID | SRR837466 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 20675581 |
| Number of trimmed reads | 20199992 (97.7%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 650261 519795 |
| Average read length | 23.24 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 19505525 |
| Number of uniquely mapped reads | 12913517 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |