| Measure | Value |
| Sample ID | SRR837465 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 20524908 |
| Number of trimmed reads | 20031571 (97.6%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 293320 508268 |
| Average read length | 23.86 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 19723320 |
| Number of uniquely mapped reads | 13122927 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |