| Measure | Value |
| Sample ID | SRR837463 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 17019359 |
| Number of trimmed reads | 16558200 (97.3%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 164669 470423 |
| Average read length | 23.765 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 16384267 |
| Number of uniquely mapped reads | 9288166 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |