| Measure | Value |
| Sample ID | SRR837462 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 16956146 |
| Number of trimmed reads | 16571665 (97.7%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 276632 402844 |
| Average read length | 23.735 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 16276670 |
| Number of uniquely mapped reads | 10752635 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |