| Measure | Value |
| Sample ID | SRR837461 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 19405906 |
| Number of trimmed reads | 18914720 (97.5%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 206993 501548 |
| Average read length | 23.85 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 18697365 |
| Number of uniquely mapped reads | 11530482 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |