| Measure | Value |
| Sample ID | SRR837460 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 20881569 |
| Number of trimmed reads | 20308137 (97.3%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 185670 581571 |
| Average read length | 23.81 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 20114328 |
| Number of uniquely mapped reads | 12949922 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |