| Measure | Value |
| Sample ID | SRR837459 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 26267481 |
| Number of trimmed reads | 18991069 (72.3%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 1818386 7278143 |
| Average read length | 23.075 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 17170952 |
| Number of uniquely mapped reads | 11058383 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |