| Measure | Value |
| Sample ID | SRR837458 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 9884613 |
| Number of trimmed reads | 9665566 (97.8%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 140123 221558 |
| Average read length | 23.505 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 9522932 |
| Number of uniquely mapped reads | 6209877 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |