| Measure | Value |
| Sample ID | SRR837457 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 20395792 |
| Number of trimmed reads | 15548796 (76.2%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 2331806 4848978 |
| Average read length | 22.8 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 13215008 |
| Number of uniquely mapped reads | 7037700 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |