| Measure | Value |
| Sample ID | SRR837456 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 12215406 |
| Number of trimmed reads | 11953589 (97.9%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 90695 264813 |
| Average read length | 23.53 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 11859898 |
| Number of uniquely mapped reads | 8407041 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |