| Measure | Value |
| Sample ID | SRR837455 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 12130326 |
| Number of trimmed reads | 11825852 (97.5%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 98779 307249 |
| Average read length | 23.565 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 11724298 |
| Number of uniquely mapped reads | 7993786 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |