| Measure | Value |
| Sample ID | SRR837454 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 15227986 |
| Number of trimmed reads | 11151274 (73.2%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 386094 4078166 |
| Average read length | 22.875 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 10763726 |
| Number of uniquely mapped reads | 7532444 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |