| Measure | Value |
| Sample ID | SRR837453 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 16815224 |
| Number of trimmed reads | 12613018 (75.0%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 1363345 4203391 |
| Average read length | 22.555 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 11248488 |
| Number of uniquely mapped reads | 7687259 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |