| Measure | Value |
| Sample ID | SRR837452 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 27232137 |
| Number of trimmed reads | 26403527 (97.0%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 1190634 841319 |
| Average read length | 23.735 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 25200184 |
| Number of uniquely mapped reads | 17652231 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |