| Measure | Value |
| Sample ID | SRR837451 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 20369705 |
| Number of trimmed reads | 19789935 (97.2%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 1132602 586281 |
| Average read length | 23.835 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 18650822 |
| Number of uniquely mapped reads | 12707978 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |