| Measure | Value |
| Sample ID | SRR837450 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 20381239 |
| Number of trimmed reads | 19859617 (97.4%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 5245408 553943 |
| Average read length | 23.345 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 14581888 |
| Number of uniquely mapped reads | 11046700 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |