| Measure | Value |
| Sample ID | SRR837449 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 17012813 |
| Number of trimmed reads | 16627246 (97.7%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 1392008 403316 |
| Average read length | 23.69 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 15217489 |
| Number of uniquely mapped reads | 10331851 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |