| Measure | Value |
| Sample ID | SRR837448 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 18884147 |
| Number of trimmed reads | 18428709 (97.6%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 1280069 487941 |
| Average read length | 23.09 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 17116137 |
| Number of uniquely mapped reads | 14009328 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |