| Measure | Value |
| Sample ID | SRR837446 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 13399846 |
| Number of trimmed reads | 13259185 (99.0%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 48884 157784 |
| Average read length | 23.81 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 13193178 |
| Number of uniquely mapped reads | 8174982 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |