| Measure | Value |
| Sample ID | SRR837443 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 20930552 |
| Number of trimmed reads | 20585396 (98.4%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 47396 368179 |
| Average read length | 23.865 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 20514977 |
| Number of uniquely mapped reads | 12982643 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |