| Measure | Value |
| Sample ID | SRR837442 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 16174535 |
| Number of trimmed reads | 15877332 (98.2%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 99640 302358 |
| Average read length | 23.8 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 15772537 |
| Number of uniquely mapped reads | 9986987 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |