| Measure | Value |
| Sample ID | SRR837439 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 15161461 |
| Number of trimmed reads | 14924441 (98.4%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 64093 242489 |
| Average read length | 23.77 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 14854879 |
| Number of uniquely mapped reads | 9361231 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |