| Measure | Value |
| Sample ID | SRR837437 |
| Adapter sequence | TGGAATTCTCGGGTGCCAAGG |
| Initial number of reads | 17830678 |
| Number of trimmed reads | 17525538 (98.3%) |
| Minimum-Maximum read length | 15nt - 32nt |
| Number of reads too short/long | 115481 313561 |
| Average read length | 23.695 |
| Number of mismatches in the mapping step | 5.00% of the read length |
| Number of mapped reads | 17401636 |
| Number of uniquely mapped reads | 10585228 |
| Counts | miRNApiRNAsnoRNAsnRNArRNA |